CBrugiaQ_788


Sequence

>CBrugiaQ_788 (2 EST) Length=460 CCAAATNAGAGATCTTTTGATTGTGAAAAAATAATACTAAAGGCTAATATGGCTTTAATATTATTAGCTTTAATTGTTGG TCGGCTGACAATACAAACAACAAATTCTCAAGCAGATCAATGTGAATTGCGAGAAATGAATTACGATTCACCATTCTGTG ATGGAATTGAAAAATAAAGAAAATGACTGCTATGTTGGTGGTGATAAGCAAAGGCTATCAGCTAAAGGTTTACATTGTGC AAAAAGCTGTGAAACATGCTGCAAGTTACCACGTTTTAAATGTAACGATCGTGGAGTTCCGTTTAAACTGTGAGAGAATG AAAACAAGTGGTTTATGCAAAACAAAAAATGGAGTACTCCTGTCCGCTAATTAGTGTTAAAATGTCCCTAAAACATGCNG GTTTATGTTNGGTCCAAAAATGTTTTTGAATAGTTAATGCCCNCCAATTTTGTCCCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_788: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7484761662347AA110600SW3ICA1827SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679951850760AA228654SW3ICA2064SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:6:18 on Fri 17 Nov 117.