CBrugiaQ_795


Sequence

>CBrugiaQ_795 (20 EST) Length=969 TTTAAACATTAAGAACTCTTTATCGGATGTTGGTAATAAATGTTACAACAAACGAATTTTAAGTCTTATGAGATAACTTC ACTCATTGCCGACTTGGAGCACCTGGCCGCTGGAAACGGTCTCCGACAATGCCGCCACGCTGACCAAAACGTGGAGGTGG GTTACGGTCCTTGCGTGCTTCACGTGAACGATTGCGCACTACTTTACTGTGAATTGCACAGGATACACAATAATGCAGCT TGTGATATAATTTTGGCAATGCATACGAGTCATAAGCAGATGCATCAGAAATATCTCGAACGGCAGCTGCTTCTACAATA TTGCGAACAACAAATTTCTTGATAGCTTTATCTTTTGGTGCACAACGACCACAATTTGTGCAGCGAATGGGTCTTACATG TCCACGACCTTTTTTATTACGTCCGTGATTTCGTCGCTTTGTTGTCATTGTTTCCTTAATCAATTAATGCCAAAGGAAAG CACGATTATTCAAACGAACTATATTCTCNAATCTCGTGCCGAATTCGGCACGAGTGAGAACCGCTATTACTCAGAAGAAG ATAAAGCAAAGTATGGGCTGCTAATTGCGATCCTGATGTTCATTTATATGATGCATCGTCCTGGTTCTCTTAATTGTGCA GTTTCCGAGAGTTCAATAAAAATTTTCTTGAAAGAAATGGGTGTTACTGAGAATAGTTGTTTTGGGAACCAAGCGGATTT GAGCCAGCTACTTGGAGCCGCACGTACTGCAGAATTCATTTCACAAGGTTGGTTAGCTTTTACAAAGGGGACGGATGAAA GTGGTTGCGAAACTGTAACATATGAGTGGGGACCTCGGGCGAAATCCGTCATCAATCCAATGGCATATTGTACCATGGAT GGTTAGTGCTCCACACCACTGGCGATTGCATTACCAAGAAGCACAGTTTATTGCTCCCTATTAGTTGAAGGAGCTTATCC TCTGTAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_795: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435275
1435286
241466837349R64711AS3ISB264SLBrugia malayi infective L3 JHU93SL-BmL3
281848890032H21337AS3ISB341SLBrugia malayi infective L3 JHU93SL-BmL3
4445941167395N43090SW3ICA1098SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459271182944N44425SW3ICA1234SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5800941382095W59881SWAMCA758SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462751502105AA032133RRAMCA238SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8558261817229AA216513MB2SLJ1A05T3Brugia malayi second stage larvae JHU96SL-BmL2
8810271871011AA241706MBL2SJ8F4T3Brugia malayi second stage larvae JHU96SL-BmL2
8810601871044AA241445MBL2SJ9A12T3Brugia malayi second stage larvae JHU96SL-BmL2
10480842064731AA406765MBAFCZ4B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481862064833AA406854MBAFCZ5H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482272064874AA406804MBAFCZ6D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483502064997AA406979MBAFCZ7H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10987752167945AA454276RRAMCA425SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10989492168119AA454450MBAFCX1G08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13666912605229AA661185MB3D6V3H01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668642605402AA661358MBAFCW3A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870752663015AA681010SW3D9CA538SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 21:42:50 on Mon 20 Nov 117.