CBrugiaQ_799


Sequence

>CBrugiaQ_799 (3 EST) Length=307 CGANTNGCNTCAGCCTCTNTCGTATCCACANGATCTCTGAATTCGGNTAATNTCGAATCGGTATCTTGAANAACGCTTTC CGCCCGAGNACANACATCAACNCTCTCTTTTCTTTCCGCATCCGCAGCAGCATCTCTCTCTCTCTCTCTCTCTCTCTCTC TCTCTCTCTCTCTCTCTCTCTCCGCGCGGGTGAGTGAGTGTGTATGTGTGTGTGTGTGTGTGTGTGTGAGACACACACAC ACACACACACGCGTGTGTGTGGGGGGGGGGCGCGCTCTCACACACACACACACACAGTGGCGCGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_799: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002521737635AA161751MBAFCF7B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195931763774AA180556MBAFCF7F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12354192369514AA584961SWMFCA2686SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:32:17 on Fri 24 Nov 117.