CBrugiaQ_802


Sequence

>CBrugiaQ_802 (2 EST) Length=527 AATTCGAGAAGCAGTTTTTGGTATTCTGGCTGTTGTCAGATGAAAGTAAATCTCGAAATTTCACTTCATATTAGGAATCC TGAAACAACAAATAGTTTACGATGTAAATTATTTGTTGGAGACTTCAGGAGTGATTCTTTATAAATTTTGTTTTTTGGGT GTAAAGTTATAATTTCTGATTAATTACGAAGTACATCTTATGCAGTTTTTAACATGCTACATTTTTATTGCACTGATATC ATCTGTTGTTTTCTTCCTTAAAATTTTGCAGTATTTGATGTAAAAAATTTGCATACTTTTCGTATTGTATATTGTCCAAA CTTTGTAGTGGTATTCCAAACAATACATTCNTAGAAATAGAAAATCTCTAGAAAAAATTGTNTGGAATACTTTTATGAAT TTTCTTCTTTTCAAATCTATGGTATTGAGTCATTTAAGTTACATGTCTCTTTAATATGATTCTAATGAGTCTACATCTGT TTTTATTGAAAATTATCGAATATTATAAACGGATTTGCAGCGGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_802: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7566161673241AA118192MBAFCE6C07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10776832130866AA433389SWAMCA1604SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 8:58:44 on Tue 21 Nov 117.