CBrugiaQ_803


Sequence

>CBrugiaQ_803 (2 EST) Length=519 GGACTGAGTAATTAATTGGACATGACGGGCACTGAACGGAAGGTTTTCCAGAAGTATTATCCGCCGGACTTTGACCCCCT CGAAAATCCCAAGAGCTAAAGGACAGCGTAATAGACAGTTTGTACAGCGTGTTATGGCTCCTTATAATATGCAATGTGAC ACTTGCCATGAATACATATATAAGGGGAAAAAGTTTAACATGAGACGTGAGACAGCGGAAGGTGAAACTTATTTGGGGCT GAAAATCTTCCGGTTTTATTTTCGATGTCCAAACTGTTTAGCCGAAATAACATTTAAGACGGATTTGGAAAATTGTGACT ATCAGCAAGAGCATGGAGCAACTCGTCTTTTCGAAGCCTTCAAGTTGTATCAGCAGGAGGAAAAAGCAAAAGAAACGAAA GAGGAGGAAGAAAAGAAGGACCCCNTGAAAATGCTTGAAAAAAGAACAAAAATGAGCCGAGCCGAAATGGAAGCATTAGG TANATTAGAGGAATTACAAGAGACAAATCGGCGACATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_803: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807421547305AA054898RRAMCA293SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6825941549422AA056792SWAMCA1526SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:48:23 on Fri 17 Nov 117.