CBrugiaQ_805


Sequence

>CBrugiaQ_805 (4 EST) Length=398 GTGGTAAGAAAATTGCTCAATAACGCCGAGAAAGTGGAGTCCCTACAATCAAATTTTACTGCTGATATCGAAACGATGGG CGATTATAGTTATGGGTTGTCCCGGGCGCAATCTAATACACTCCTCCACTCACATCGGCCCAGAATACTAGTAACTCGAA CAAAATCAGNACCGGATCTTGTGAATTATGTAAGAAGAAGCAGTAAATACACGCCTCAGTGGGGCTATAGATTCTGGCCT GATTATGATTTGTACGATGACTGNTGGGCATGATCGNNACAGTGGATTCAGACCACTTNNCAGAAGTTCATACTATCCAC GGNGTTATTATCATCCAGNTATAATGCCACNTCCGNATGACTGGAGCNGGNCNCCTCCCACATGGNAAANNATGGNGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_805: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4351161154123N33723SW3ICA627SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4427031164851N41253SW3ICA655SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447961167693N43311SW3ICA858SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304351300185W23331SW3ICA1462SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:57:51 on Wed 22 Nov 117.