CBrugiaQ_806


Sequence

>CBrugiaQ_806 (2 EST) Length=736 AAAAAAAAAAAAAGCTTTTAAGAAGCTTAGGAGATCTAGAAATATAACAGTGGACAATCTTAAGCATCTTATTATCCATG AACATGTGCAAATCAGACAAGAGAGAAAAACAAAAGCTTAGCCATCTACAACTCTAACTTTGAATATTAAATACAAATTT GTTTAAAATTCGGAAGGTTGATGTTTCATCCTTTCTGCAGCCCATTTTCCATAATCAGTCCATACAGCTGAAACTGGCTC ATACCACCATGCTTTATAATCCCAACGTTCACCTTGTAAATGCTCCACACGTTGTTCAATTTTCCTCCATCTGCTCAAGA TATTTGCTTTCTCGAAATATGCAAGATTGCGTTCGTACTGCTCAATATCTGATGGGCAAAGATATTTCGCAGCCCATTGT TTCAATTTCGTTCTTTCGAACTGCCAGTAGTGAACAGCGGATCCATCAGTTGGCAAATCTTGCAATTCACAAGGTCCATA AACAACATGGATAAATCCAAGAAGTAAAACCATCGGCATAATACCAAGGCAAATAACATAGAAATGAGCGATATCTTTGC AACGATTAAAATAAAGAACCGATGGACGTCTATAGAAAATTCGATCAGATGAAAATCTTGCCGGTAAAATGGTTAATCGT GCAACACAAAGACATTGTTTAGCAAGCTTACTGAAAGCTGCCATTGCCGCGTGATACTATTCCGCCGTCACTACTTTACG CCAGAAACTCAAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_806: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472361660846AA109376MBAFCE1C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002111737594AA161584MBAFCF1E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 9:3:35 on Sat 18 Nov 117.