CBrugiaQ_807


Sequence

>CBrugiaQ_807 (2 EST) Length=522 GAAAAAAGAAGAACCTGATGGTGACTCAGTTCTTGGTGAGACGGATTCGAGCGATACTGTGCCAAGTTCGAATGCTGTTC CTTCGGCTAATTTATGCGGTGCAAGGACAGAGGAATATGATGTTTGGCTGGTCAGGAAGCCGACAAAGGTTCCATTGAGT GATTTGTCATCGATTAAATTTCCTCACAAGGCAAAGAATCGGATAAGGCTTGCAATTCCATCTCGATCCGATGCGGTACC ACTGAACTGTCATTTCCATCATCTTACTCTACCCTATGTTTATATTCCAATTGCTGGTATTAGAACTCCAGAAAGGATGC TATGTCCCTTAAAGCCCACAAATTTGATGAAAGGAATTGTTGATAGTTGAACGAAAAACTTGATTTGTTAAATAGTGCTG TAATTCTCACGAAATGAAGAATGGTATTACTGTTAAACAAGAAACTGGTACACTGTTGGAAAATGAAATACATGATATGA AGTTTCCAAAATTAAATCAATTCCCACAAAAGCCACAGTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_807: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7272381634883AA089404SW3ICA1766SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10988062167976AA454307MBAFCX0A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:39:40 on Sun 19 Nov 117.