CBrugiaQ_81


Sequence

>CBrugiaQ_81 (3 EST) Length=830 AATTCCTCACGGTGGGTTTAGCATTCTTTTTAGGTGGAATAATTTCTTTCACCATTTGCATTATACGAATATTATGGGAG GGTATCCAAAGCACCAAATAAGTNATTCCATTCAAAGTGCAAGCGCAAACNTNGCAAGTGACAGCATAATTATTTGTTGT GGTGAGAGAAGAATAGCCAAATGTATCATCATAACATGTGTTATAGCAAACTGAATGATTTGACCAAAGGTTATGAACTG GCCAATCTGTGGTGGAACACGTATACGAAGTGATCGTAGCATGTAATAACTGTACATAAAGGAATGTACGTGAAATTCAG CCAAACAACCCAAATCATGTAAGCATTTTTATTGGCATATGTAACGGATTGCGAAATATCCTGTAAGCGCATGATGATAC CAATGCATTAGCATTAATGGACGTTTCCTCAAAACGATAAAAATCGTGTCCCAAAAGTTCCGGAACCTTTGAGATAATCC ACAAGAAAGTCCAATAACCAGCAACGTCATCAGTGAAGCATGGCCCTATTTCAGTGAAAGTGCTGATATATCCTTTGGTA GCCATTTGTTTGAGGAAAACAGGTGTTATTTTAGCAACACCAAGAATGCTAAAAATAGCCAGCAAAGCATTCCAGATAAC AAGCGGTTGCTGTAAATCGTATGGTTTTCGATCACGCATCGCATATTTGACGATAAAAATGCTAACAACATACGTCAATG ATATATTCAATATAGTCCATTCCATTTCTGATGCCCATTTTCGTGCTGGTTCAAATTCAAATTTGGAGCTAAATATGAAT TCCATTTTACCCTTGGTCGCTTAATTCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_81: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8810291871013AA241708MBL2SJ8F7T3Brugia malayi second stage larvae JHU96SL-BmL2
11918782307120AA545829SWMFCA2329SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139162334998AA563533SWMFCA2496SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:29:4 on Sun 19 Nov 117.