CBrugiaQ_814


Sequence

>CBrugiaQ_814 (2 EST) Length=502 ACCCAAGTTTGAGGAAATAACATGGTTTTAAGAGGTAGAGCAGGAGAAACTATGCTGCTGATCGCAGTAAATCTCGTGAG CAATATCACTAGTGGATGCAGTTCCCTATGGATACGCTAGACCTTCACCCCTAAAAGGTAATGGTGCAGAAAAACCACCA GAGTGTCAAAGATGGACAAGATGAAAGCAGCAAATATTACGGCGGTAAAAAAGATATGATGCTACCCCAACCACGCGCAC CTCCTAGCAGAGGATATGAAGCCATTAGCAAAAGAGGCCAAATGTCGTATGCACGTCCGAGTTATAGCTAGGAGCACTGC CATTTCTCGCTTGCAAATTCAAAATCGTCTATCATCTACTTCGTTTACACCGTCTGTCTTTAACTTTCTGCGAAGAACGT GAATTATTTCGATAAGTAATTTCATCTCCACTCTCAAGGACAAACCAAGTTCTTCCTGTGTATTATCACTGTTTTGAGAA AAATAATAATTTTACGTTNGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_814: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450041172386N43503AS4SLC805T3Brugia malayi L4 JHU93SL-BmL4
5595421345363W51516AS4SLC950T3Brugia malayi L4 JHU93SL-BmL4


Date: 8:46:27 on Mon 20 Nov 117.