CBrugiaQ_815


Sequence

>CBrugiaQ_815 (2 EST) Length=515 GAATTCGGCACGACGTTAGAGCTCTAGCAACAACAGTACAAATGCGAACGACACTACGATGTGTGTTCCCTCTTGCTGCT CCCTCTACTGCCTATTTTTTATTATCACGTGCGTATAGTAACGGAAGAGGTAACAGAGGACCAGAAATGTTTCAGTTGGA ACATGTACGAAAGAGGATAGAAATGACGGCTCCACATTTCTTTCGGGAACGGCCAGATTATACATTTTACAGGCCGGATG TGTTGTATAAAGATGAGATTTTTCAGATTACTATTACGGGTCGAGACAAACTCATGATTTATTTCGGCTCGATTAGTGTA ATATGTCTATTGTGCTTTCCTCACATAGAAATGGAAGTTTTGGNTATATTACCGATCTCAGAAGATGGAACAGCACGATT AAGGTGGCGTNTTAAGCATATCTCATTGATACGATCGCTGTTGGAATCCTATGTTGGNCAGATATNATTATCGTATCAAG AGGTTGGAACATGGTACGATGGTCTTTACAATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_815: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5596551349161W51733SWAMCA630SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5771561378368W69068SWAMCA995SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:49:58 on Tue 21 Nov 117.