CBrugiaQ_818


Sequence

>CBrugiaQ_818 (4 EST) Length=514 GAGGTACGAAGGAGGAAAAGGAATCGTGACAATGTTGGAATGATATCAGAAAAATCTGAAATTATTGTTGCAAAACAAAT ACACTACAAGAAACATAGGGGTTTGACAAATGTTGAAGTGCGCAAAGTCCCAGTGCCACCACATCGGTATTCACCACTAA AAGAGCACTGGTCAAAAATTATTTTGCCAATCATCAAGCAGTTACATCTACAAATAAGATTCAACCTGAAAACACGAAAT GTGGAAATTCGTGTATCGAGTGAGACTGAGGATCCTACACATTTGCAAAAGGCTGAAGATTTTGTCCGCGCTTTTGTTTT GGGTTTCGATGTTGATGATGCGGTAGCATTAATTAGACTGAATCATTTATTCTTAGAAAGTTTCCGAAATTAATGATGTC TAAGCCCACTAAAAGGAGAGCATTTGTCACGTTGCTATTGGACGAATTGCTGGCAAAGATGGTCGAACCCAATCCACAAT TGAAAACATAACTAAANTCCGTATTGTGCTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_818: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281257890014H21319AS3ISB207SLBrugia malayi infective L3 JHU93SL-BmL3
7062151592633AA072532MB4SLD051T3Brugia malayi L4 JHU93SL-BmL4
12617492392945AA585533SW3D9CA111SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13668682605406AA661362MBAFCW3B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:45:48 on Fri 17 Nov 117.