CBrugiaQ_82


Sequence

>CBrugiaQ_82 (5 EST) Length=720 CAAGTTTGAGGCACGATTAAAAGTTCTCAATTGGGATATCGCGGGAGTTTTACGATTACTCCGTGAAGTGGCTAACGTTT AATGGATCAGTTAGAAGTGAAAGAAGTATGCTCCACTTCCGGCGAAAGTTTCTCTTCTTCATGTGAAGATAATGATGATG ATGAATCTCCCACAACACAAAAAAAAGTGGGCAACGAGAACACGGTTGTTTTTGACGATGGAAAACAGCAGAAAAAAAAG TTGAAACGTACGAAACGTGAATTGCGAGCAGAACATGCAGCGAAGCATAAACGGGATCGAATGGGTATGGTATTGCCAGA TCCAGTACAAGATCGGGAACGGGAACGCAATTTCGTTCATCTTGCAACAAAAGGTATTGTACAACTATTTAATGCTGTGG CCGAACGACAGAAAGAGCTAAACAATGCATCAGCAGCAAATAAAAAAAGCNAGAAACGTCGATTGCNTGATACTTCTGCN GAAAGCTTTAACNGGAAATTAATGGAATCCAAGTCNGTTAAGGGATGAANCCNATGATNCCNAAGAAGATTGGCTATCTG ATGATCCGACGGCAATTNNNTGTNAGACCGAGGACGACTTNGATCTTCCGGAGTTTAGACGAACCCGAAATTGATTCNGA ATGAAATCCTNATGTTGCNCGTTGTTTCCCCTGGAAANATTTTGTTAACTAAATTAAATTTGGTTCCCTGTTNCNGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_82: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291598902130H30974SW3ICA223SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7522721668256AA114425MBAFCE3C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8679611850726AA228607RRAMCA372SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10859932153577AA441699SW3ICA2511SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12774442429586AA598393SWMFCA2963SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 21:46:15 on Fri 17 Nov 117.