CBrugiaQ_823


Sequence

>CBrugiaQ_823 (2 EST) Length=298 ATCAAACTTATCATCAGCAAGTGCACAAACTGCGGCACGAGTCTCATCTTATCACAGCGATCAACAACAACAATATTCTT CCACTCAATATCAAAGCAACAATGGGACGATACCTAACGAAATACCTTATATTACTGATCCAAAATCATATATCCGACCA TATGCAACACAAACACCTGCTTATACAGTAATGGATTCACCGCCACGAGAGACATTTTATCAGACTGTTAACAGTGATTA TCAACGATATCAGCCTAATAGTAATATCAACAAATCTTATCAGTTTATTAAGGAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_823: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12619242393120AA585708SW3D9CA500SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13247932539436AA627049MBAFCW2H09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:21:40 on Sat 18 Nov 117.