CBrugiaQ_835


Sequence

>CBrugiaQ_835 (2 EST) Length=515 ATTATATAACCTATCCTTAATTTCCGACAGTTCTTTCTCTATCTGCTCTCGTGCCAAATTCGGCACTGTTTTAATAGTTT CAAGTGTTTACAACTCGGACTTCTCGATGAATTCTCAGTTACGGAATTTTATGTCAAGTACTTTGGAAACTTTTGTTAAA TACTGCAAGTTATTCATGTTGGTACTTTTGTTCAGCTTATGATGCTTGGTATGTTGTTCCACATGTATTTTATAACATTT GCTGTCTTAATGCTTGAAAATGTTTCACTGCAAGGGGAAGTTAAGAGCACAATACTCAGCCACTTTCTCCTTTTCTAATC TCTCTTCTTCTCACGTTTCTATTTTTTACATTTCATGTTTTATCTTCTCTACAGGCTGGAGTTTCATGTGAAATATTTAT TCACCAAATTTGCAAAAATTTTGACATTTGATGGATTTCCTCCGTAAATTTTCGAATTTGTTGTCCATGTTCTAAAAATG TTTTGGAACTTGCAAATAAATCTTGTCTGAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_835: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002421737625AA161741MBAFCF1H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10901952158566AA445901SWAMCA1856SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:49:6 on Sat 25 Nov 117.