CBrugiaQ_840


Sequence

>CBrugiaQ_840 (8 EST) Length=471 GCGGTTTATTACCCAAGTTTGAGGCTTTGTCCAAAGCATAATGTCGGACCCTCAATCAATTGAAGACCCAAATCCAAATC CTGATATCGAAATCGGAAATGCTCAGATTATTGCATCAGGTATGGACACTGAAAAACAACAATACGCAATTCAGTGTGCC AATGAAGCTATTATGCAACATCCAAGTCAAAATATGGCAATGGCTCAGTATATAATGTCCCATTTCGAGGAGAGATATGG CTCAGCATGGCACTGTATCGTAAGTGATGGAAATTTGGGATTTTACGTACGATACGATCCTTCAAATCATATCTATTTCT TTATAGGATCAACTACTATATTTTTATTTAAAAATGAATGCTAATAATTTGGAATTTCTTTTGGCTTTTAAAACTTTAAT TTCATTTTCATTTCAAATCAATACAACAGTTAATGAAGAAAAGAATGAGCCAATAAAAGTTGAGTTTCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_840: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217699808521R47634AS3ISB021SLBrugia malayi infective L3 JHU93SL-BmL3
241465837348R64710AS3ISB263SLBrugia malayi infective L3 JHU93SL-BmL3
281221889978H21283AS3ISB079SLBrugia malayi infective L3 JHU93SL-BmL3
3644661017393H63047AS3ISB078T3Brugia malayi infective L3 JHU93SL-BmL3
4449711172353N43470AS4SLC825T3Brugia malayi L4 JHU93SL-BmL4
4809721236209N74810RRAMCA1081SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5061211270748N99333TNPIBM3003Brugia malayi infective L3 JHU93SL-BmL3
5594371345258W51545AS4SLC622T3Brugia malayi L4 JHU93SL-BmL4


Date: 9:53:55 on Fri 24 Nov 117.