CBrugiaQ_843


Sequence

>CBrugiaQ_843 (3 EST) Length=508 CCAAGTNTGANCTTTCGTGTGCAATGTATTCTTGGCAATCGGAATAAGACTAGCAACAATGTCGGAAGAAATGAATGGTG AAACTTTCGCGTTTCAGGCGGAGATCGCCCAACTGATGAGTCTCATCATCAATACATTTTACAGTAATAAGGAAATTTTC CTCCGTGAATTGATTTCGAATTCCTCGGATGCGCTTGATAAGATTCGATACCAGGCGCTTACTGAACCAGCCGAATTGGA AACTGGAAAAGAGTTGTATATTAAGATTACTCCGAATAAGGCTGATAAGACGCTGACCATTATGGACACGGGGATTGGTA TGACTAAAGCAGATCTGGTTAATAATTTGGGCACAATTGCTAAATCTGGCACCAAGGCGTTCATGGAGGCTCTCCAGGCA GGTGCTGACATCTCCATGATTGGTCAGTTTGGTGTTGGGTTTTACTCCGCATTTCTGGTCGCAGATAAAGTTGTTGTGGC CTCCAAACACAATGATGATGATTGTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_843: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061631592581AA072508SW3ICA1513SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7496451663649AA111759SW3ICA1736SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9141741912544AA273170SW3ICA2598SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:54:33 on Fri 24 Nov 117.