CBrugiaQ_844


Sequence

>CBrugiaQ_844 (6 EST) Length=528 TCGGAAAACAGATGAGCTTACAAGGTCCATAGTAATCGAGAGTAACACCTGCAATAAACGTGAAATAAGAATTTATTAAA TGAATACTGGAATACTATCCACTGTAGCATATCGATTGTGATGTATGCGGATATTACTATGTCATTGTAACCTCNAGAAT AAGTCCATCATACCAAATGCCAGCATACGTAAGCAGCTCATTATGGTTCCGGTTCAACTCCAGCTTGTGTCATTAGATCA GTTATGCTCTTTTCCAACTCATCAATACGTCTTGTCATATCATCTATTCGACCAATAATTTGATCAGACATGCGCTGAAA ACGATCCTGCGTTTGTTGCAATACTCCTTGTATCAGTGAAGTTAGCTCTTGCAAACTTTGCTCGCTAGATCTTGCTTCTG GCAAAACTATGGAATCACTTTCACCGACCTTTTTTGTCACCTCATCATTACTTTTTTCCGTATTTGGTTGTTCTTCATTC TCCATTTTGTAACTTTCTTTTTCGTTTCTACATCCTCGATTTGGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_844: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435287
4061401115045H97273KJ4SLB064T3JHU93SL-BmL4 (JHU)
4157061122649H98428KJ4SLB123T3JHU93SL-BmL4 (JHU)
8558071817210AA216470AS4SLC730T3Brugia malayi L4 JHU93SL-BmL4
9214661923317AA280456SWMFCA1988SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11887542289618AA542706MB4SLY2C12T3Brugia malayi L4 JHU93SL-BmL4


Date: 21:46:18 on Mon 20 Nov 117.