CBrugiaQ_847


Sequence

>CBrugiaQ_847 (2 EST) Length=740 GCAGGGTATGATGAGAGTTCAGTAACCNAGTCCCCNTCTCCTATCCATATTCTCGCTGTGTAATGCAGATTCTGTTCGCG TGGGATCAACTGGAAAGTNCTTGCACTTGGCCTTTGGCGTCTNCGATTTTGTTTTTTCTGGTTGTAAGTGATCGGAGATA ACAAAGGGTATTCCGGGTATGCTGGGTACCCGTATGATATGGACGTGCGAATTAACCAAACATGTCTCCAAGATTGGTCC TTTTTCGACCAGTAAGAAATCTTTTTGGATTCACCGGAACAGAAAAGTATCGGCGACGCATTGATGAATTTAAAGAGAAA ATAGAACAATCGAAGAAAAAATTACCTTATCAGGAAGATGTGATTCCGCTTCCTCCGTTGAAAGATTTATGCGAAAGCAT TCGGGTGTACTATTGGGGTTGGATCTGTGTCATTTGCGTCGGCTACAATATGTGATCTTAAAAGATCCAACAATAAGTGG CCTCAACTTTATGAAATAGTCAATGTGAAATATAATGAAGCCAAAAATCATTTCGCCAAATATCGCCGACTTCGAGATGG TGTCAAATGCACTTTTATACTTGTTGGCATAAATGTGATGGTGATGCTGATGTGGGGGATCAAACCTTGGCAACTATTTA TGTGGAGATGGTTCACAAACAGTTTTGCTTCAAAAGCTTTGTGTCTTCCAATGGTATTAAGTGCTTTTTCTCATGCAAAT ATGCTTCATCTTGTGTTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_847: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214601923311AA280450SW3ICA2610SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11253532209421AA480723SWMFCA2080SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:52:40 on Sat 18 Nov 117.