CBrugiaQ_848


Sequence

>CBrugiaQ_848 (7 EST) Length=639 CAGTTTGAGCACAATAGCAACAAAAATCCCTGTAACGAAGTACTTTCGACCATTTGTGCCACCATTACCGCCTGGCACAA AAATTAGCAACGATTTATATTGGGATCTATATATTTATCGGCCACTTTGTCGCCTTTGGGAACGTGTGGGTGTGTATTTG TACAATCGAGTGATTAATCGCTTCGAAATTGGCGTAAGAGATAAAGCATATAATGCTCGCATTCATGGTCCTTACTGTCC TTGGAGATATTATGGAACTAAAAAAGATACAAAATTGATGGATGTGAAATTATGCGACCTACCAGCGTGGTTTTCACGTC GTGACAAATCGATTGGAGGTATTGCAAACGCCGCTGTGAAAAGTTTTTACAGATTCGAGCATTACTATTTCGATCACTAT CTTATTAATTTGCCACGATTCTTCTTGCGTTTCGTTCTTTTGGCTTATCTGCTGGGAATAATACTTTTCTATGATGAGAT TCCAGCTTCTGTTGCGCAGTATCACTGGTGATGCAGTAGATGTATTTTGATCTTTTTTTGATTGCTTTGTAATTCTAGTT GTATTATTTATTGTGCTCAATATTTCGTAAATATATGTTAAATTTGGAATTTGCTGCAGTTACAATAAATTTCGCTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_848: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281238889995H21300AS3ISB256SLBrugia malayi infective L3 JHU93SL-BmL3
281258890015H21320AS3ISB346SLBrugia malayi infective L3 JHU93SL-BmL3
5014581266979N94698RRAMCA1170SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304381300188W23334SW3ICA1468SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6965241566674AA068392SWAMCA1557SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7471821660792AA109256MBAFCE0E06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472501660860AA109390MBAFCE1D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 3:4:27 on Tue 21 Nov 117.