CBrugiaQ_851


Sequence

>CBrugiaQ_851 (3 EST) Length=510 GAGCACTAAAACGGTAGGGTGCGTGGTCGCCATAGAATTTTCGAGATGTCTTGGTTGTGGGATTGGGTGTCCGGCATGCT TAATTATCTCGGTCTGACTAAGAAAAACGGTAAACTAGTTTTCTTGGGGCTGGATAACGCTGGCAAGACGACACTCCTTC ATATGTTGAAAGATGATCGTATGGCCCAACATGTCCCGACACTTCATCCTACTTCTGAAGAGCTTTCACTGGGTGGTATG CGCTTCACAACATTTGATCTTGGTGGACACGAACAAGCACGACGTGTTTGGAAGGATTATTTTCCAGCTGTAGACGCTAT TGTATCTTCAGTGGATTGTGCTGATGTTGAGCGGATTGCGGAAAGTAGGCGTGAGCTCGAAAGTTTGTTGGGGCGATGAG CAAGTGGCTTCTTGTCCACTACTTATTCTCGGNAATTAGATCGATAAGCCAAATGCATTAGGAGAAGATCAACTGAAGTG GCATTTGGGAGTATCAAACATGACCACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_851: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451091182136N43556SW3ICA862SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4812051237175N74866SW3ICA1444SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10482452064892AA406887MBAFCZ6F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:45:6 on Wed 22 Nov 117.