CBrugiaQ_855


Sequence

>CBrugiaQ_855 (10 EST) Length=524 AACAGTAAGCTTTATTTTCCGAATTACGGAAATAAATAAAAATAAAGCATTGCAAGTTGCAAAACGTAAAAATACAAATT ACACCAAATTAGAAATTTAAGAATTACTTTGTAATCAAAAAATACAAAGAAAGAAGTTACACCAAACTTCATCATTTTAG GCAAATTGGACAAACTTAACAAGTCTACATTTTTAACAATACCATCCAGAACAATTTCCGTCTCAGCAAAGTGCATTCCA TACCAATAACTCATACGCTGATCACTTCTGTTTTCTGAGTACTGATGTTTAGAGTTTCCAAATTAATGAATATGTCTGGG TCATAGATTACTCGAACAATCAGTGAACAACTAGGACAAGCAGCAACATCTTCACCAGCTTCTAACATTTCCTTCGAAAT TTCAAACCGATCACCACACGGGCATGGATAACTATATAATTTGGTAGACTCGTTATAGTCAAAATCTTCGATCTCCACTT CATCATAAAATACGGACATTATATATCCATTAATTACCTCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_855: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4459641182981N44462SWMFCA184SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8557981817201AA216497AS4SLC705T3Brugia malayi L4 JHU93SL-BmL4
8809271870911AA241619MBL2SJ2C5T3Brugia malayi second stage larvae JHU96SL-BmL2
8811001871084AA241420MBL2SJ9E9T3Brugia malayi second stage larvae JHU96SL-BmL2
8982611892866AA257390MB4SLM2D1T3Brugia malayi L4 JHU93SL-BmL4
8985491893154AA257677MBAFCZ2G6T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480302064677AA406685MBAFCZ2G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161682199309AA471545MBAFCX3G01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11587762252953AA514136SWMFCA2240SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11887362289600AA542688MB4SLY2B03T3Brugia malayi L4 JHU93SL-BmL4


Date: 10:25:57 on Mon 20 Nov 117.