CBrugiaQ_858


Sequence

>CBrugiaQ_858 (3 EST) Length=646 CAAGTTTGAGGTATATTTGTTAATTTGTTTTATGGTTTTGCTGGTGTTGGATATTCGTTCTAAGTTCGGGAAATGAATGT CGAAGTTTGTACTTTGTTTGAACCACTGAACCCGCATAAAATTTTCATTTTGGAAAAACGGATTAAGAAGAAGATCAAAA TCCATCGGCAGCCGATAGAGAGTTTTATAAAAAGAAGAACTGTCAGAAGTGATATGGAGAGCTTGAAATATTCGCAATTC GAACCGCTCTATGAATTGTGGTGTGACTATTTCAGTACCCTAATTAATGGATCCAATGGTCAGTTGGATGCTCGAATGTT GAAAGCCGATTATCATGGATGTCTGCTGATGATTGTCGAGGCTGCTAATCCAGCTCAGGTCGGTCTTTGTGGCATTGTGA TTCGTGAAACTAAGGCAAACCTTCATGCTGATCACAAAACAAGACCGCTTGCTAACTATTCCAAAGCAAGATACTATATT TCAATTTGCACTGGAAGGGCAAAATATATCTTTTGTTCGGGAATGCGTTCAGATTTCAACCGTCATTGCGAGCAAAAAAG ATATTCAAGAATCGTTGTTCAATTCCCTTCTTTCTAAAATAATATTTGGTATTATTTTCTTTTCATATTGCATGAATAAC ACGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_858: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482772064924AA406932MBAFCZ7A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162832199424AA471660MBAFCX5B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247412539384AA626997MBAFCW2C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:46:58 on Thu 23 Nov 117.