CBrugiaQ_863


Sequence

>CBrugiaQ_863 (12 EST) Length=549 ATTCCAATAAAANTGGAAAGCCTTCTTAATCTTTATTGTCTTTTTNGGCGGACTATCTTTATTCGATCCGTCGCTTTCAG TGGTTTATCATCCTTGGAACCATTCAGCTGTCATATCCAGGATGTGATTTTGCTCGGAACCTTAATTACAATAATATTAC CACCATCACGCTGTACTATATGAGGCTTATCATGAAATTCTGGTGCATTTCCAGCTTTCACAGTAAATGTAGCACTATTT TCGCCATCGCTGCTGTAGAATTTCGCCTTATATGAACCCGCCAATTCCTTATCGAAATTCTTAATTTCACATCTTAACAA AGTTTTCTTTTCGCCTTCATCGTGTTCTGAGAAGACGTATGTTTTAGTTGGCTCAATTTCTTTCTCGCCCAAAAACCACT TTGTCTTTTCAGGCAAAAGACCGGATGCGATCACTTCTAAAAAGACACTGTTTGTTGCGCTGTCCTGTACAATCTTCGGT TCCCCATGTATTACTGGCGGCGCCATTCCGGTGCAACCTCAAACTTGTGCCGTAATTAGGCACGACCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_863: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
300002914371H39290SWAMCA285SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
354105992879H52883SW3ICA427SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4157111122654H98433KJ4SLB128T3JHU93SL-BmL4 (JHU)
4448101167707N43187SW3ICA905SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8249051769734AA185846SW3ICA1945SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679661850731AA228625RRAMCA377SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8984171893022AA257520MBAFCZ1B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9214441923295AA280434SW3ICA2489SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9246531927223AA283565SW3ICA2708SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10987382167908AA454239RRAMCA193SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11539862247200AA509323MBAFCX9H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617532392949AA585537SW3D9CA115SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 11:13:31 on Sun 19 Nov 117.