CBrugiaQ_865


Sequence

>CBrugiaQ_865 (5 EST) Length=559 CTNTATTCNGCAACTTCATTTATTCTGGGATTGTAAACACCACACAACTCAATTGAATAAAAACAGATCAATAACGAAAT GAGAGGATAACAAACTGCAGTGTAAGCCTCAGATAGGTTTGATTTTGAAATGCATGCCAATTAAAGAGAAAACCAAACAT TTGAGATCTTGAACGAGATAGTAAAAGGATCTTAATCCTTCTGGATCCCTGCTTTTGTTTACGTCTGCCGCGGAACCAAT TTTACTTGTAGTGAAAGATATATGTTCATCATTATGAAGAATTTCTAATTCTTGTCTACCAATGCGATCCGGTTCTGGCC AAGTTGCGTCATCTTCCTGCATAATTTCCGAATCATCGATAATACGCTTCAGTTCTTCAATAACAATTTTACCGACATAT GCTTCTTTCCGGATCAACGTGTCATTCTTGTACTGACTATTATTTGCATACCGCATCTTGCCATCCGGACGGAATTCGAA TTCTAAGAACTCATGACCGAACTTCCCTTTATGACCAACATAGTAACGCAAGTAGAAATCATTCAGATTATCACCTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_865: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808771870861AA241543MBL2SJ0F9T3Brugia malayi second stage larvae JHU96SL-BmL2
8986311893236AA257746MBAFCZ3G2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986831893288AA257798MBL2SJ3D1T3Brugia malayi second stage larvae JHU96SL-BmL2
11162692199410AA471646MBAFCX5A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163392199480AA471716MBAFCX5G05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:7:41 on Sun 19 Nov 117.