CBrugiaQ_877


Sequence

>CBrugiaQ_877 (7 EST) Length=907 TNTCNGCATCTTTTCCGACNTCNANGGNGGGCCCNCNTGAACAACTTTTAATAGTTTTTGGGTTGGTAATTCTTTTTGTC ACACCACTTTATGCAAAACAATCAATTGAAGAGGAAGAAGAAGAGATGAGTGACGAAGAGGAGGAAGAGAAGGAGGAAGA GGAAGAAGAGAATGGAAATGAAGAGAAAGAGGATGAAGATGATGATTATTATCAAGATGATAGTGATGAGAAAGAGGAGG ATGAAGAGAAGGAGGAGGATGAAGACGAGGATGGTNGTGAAGAGAAAGAGGATGAAGATGATGATTATTATCACGATGGT AGTGATGAGAAAGAGGAGGATGAAGACGAGGATGGTAGTGAAGAGAANGAGGATGAAGATGATGATGNTTATCANNACGA CAGTGATGAGAAAGAGGAGGATGAAGACGAGGATGATAGTGAAGAGAAAGAGGATGAAGAAGAAGATAAGGATGATAGTG AAGAGAAAGAGGATGAACAAGAAGATAAGGGATGATAGTGAAGAGAGAGAAGACGAATATACTGCCAANGGGGAATTCGT TGAAACAGACGGCAAGAAGAAACAATGTGACTCTCACGTAGCTTGCTATGATCAACGTGAACCACAAGCGTGGTGCATAT TAAAGAGAGAATCAGTCTTGGACAAACAAAGGTTGTTTCTGCGATGAAAAGAGACATTTATGCGTCATGGAACGGAAGAA CGGCGGTAAATTGGAATATGCGTATTGCGCGCCTGCAAAGAATTGGGAAGTGTTCGTACGATTAATAATAACCTACGATA TTCCTCCATTTCCTATTTTAATATTTCAATTCCTTCTAGCAGCCTAGCAATGTCTGCTGTGCACTTTAACTTTTATTCAA TATAATCTTCTAAATGAAATGATATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_877: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217606808428R47541SW3ICA107SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
281196889953H21258AS3ISB330SLBrugia malayi infective L3 JHU93SL-BmL3
291620902152H30996SW3ICA251SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446861167583N43201SW3ICA1123SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061701592588AA072515SW3ICA1521SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618392393035AA585623SW3D9CA340SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13667872605325AA661281MB3D6V5A10T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 20:12:33 on Sat 18 Nov 117.