CBrugiaQ_880


Sequence

>CBrugiaQ_880 (2 EST) Length=648 GGNTTTGGAATTCAAAACACCATTGTTGTTAGGGGAATGGAAANAACAATTGAATGGGATCACCGGGAAGGTTCAAGTTT TCGTATTTCTTTCGGATTGGGTTTCCAGCAAANGTAGGATTTNATCATCATCTNGTCTNNGGAAACAAACATTTCAACCT TCAAAATCGGACCAGCTTGTATTTTCGGGGCTCGGAATTAAACATTCCAACTAATTTATCAGGAATAATGTGCATAGATG TAGAATAATGGACCAAATCGAATGATTCGATTTGGTGGTTCGCCTTCTGCATGCGTATTTATCACTTCACATAGAAATAA CACTTCACGCATTACATAATCTCCTGCTCTAATACCACGTGCTTCCGTTTTAGATCCATGCGTTGGTCGGACCGTAATCT TGCGCACTTGTATCATACTTAGGTGCTGTATATGTTGATGAAAATGGATTCCTGTCGAGTTTCTCCTTTGTTTTCATTAG CAATATTAGTGAACATTTTAATTGTGTCACGTGCGCTTCTACCAATCATTCGCAAATTCGGCTGACACTCACTTTCACTC TCAGAAATATTAGAGTCTTTCCNGTTTCTACAAATTTTTTTNGCATACCANNAGCGACAATATTATTTCTTCCAACGAAG CAGATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_880: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217614808436R47549SW3ICA119SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9245601926162AA283468SW3ICA2015SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:45:40 on Mon 20 Nov 117.