CBrugiaQ_881


Sequence

>CBrugiaQ_881 (6 EST) Length=842 CAATTCCTNCCATAATAAATTTCCTGTTAGTCCTTTTCGCAAGGAGTTGGTATTTGTCCNTTGTTTGCGCCTCGTTTTTC TCCTTCCTTTGNTGTTTTGTATCGTCAATTTACCATCTTTCGTTAATTCGCTCGTTACCCAATTCAGGTTTTATATCTTT TGGTAGCATTAGACGACGGGTAAATTGACGCTCAATTTCTCCCAAACTGATCTTTGATCATTGGATGTTTACCCTCAATG GTAACAATTCCATCACTTACAGATACTTTCAAATCATCGGGCGCAAATTGTGATACATCAATAGTCACCGAGTAATGCTC ATCAGTATCGGTTATCTCGCCAATACCGGAACCTAATTTATGAGAATCTTCGAATTGATAATCTGTCCAATAAGGACGTT GAAAGAATGGTCGCTCAATGTCGAGATCACGGAACTCATCGAAAAATCGACTGAAACGTGGTGAAAATGGTGAAATTAGC GAACGTCGAGACCATTTNGTTTCAAATTTGAGCTCAAACTCTCGTGCCGAATTCGGCACGAGGTTGGGTACTGTTACATT TGTTGTCCCAAGGATTTGAGAACTGATAGGCGAATTTCGCTTTGAAATGGGTGGCGGTCGTCGACGTCGCATTGAACGGT CCTCTAGTAGTATTGATCGTCGTTACAAACGGCCATGCAATAGTTCAGAACGACATCGACGGAATGAATCACGCAATCGG CGCGCCCGTAGACGATCGTGGAATAAAAAAAATTCTGATCACTTCACATTTCAGAGTGATCGCTCTGATCGCCTACAACC GGCATCTTCATCGAAGTCACATGTAACTGGAGCTGGACAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_881: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
354094992868H52872SW3ICA414SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5477091322263W39852RRAMCA158SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8001901737573AA161563MBAFCF1B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985711893176AA257699MBAFCZ3A5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480522064699AA406733MBAFCZ3A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652372402608AA588945KJ4SLE039T3JHU93SL-BmL4 (JHU)


Date: 14:16:33 on Mon 20 Nov 117.