CBrugiaQ_882


Sequence

>CBrugiaQ_882 (5 EST) Length=493 ACTTTTGTCACCCACCTACCCATCGGGTAACAATAATAACCAANCGGGAACCCGTTGTATGACCAAGGCGTAATACAAGC ACTTCACATCAAGTTCACCGATCTTTGAAAATATCACCATCCCTCACCTTGTTGGTAATACTTGCAATACGATCATCACC TCCATAAATAGATAACCCACGATATTCGTCAGAAAGCTCATTCGTCGCACCAGCATGATCCCAGTGATGATGAGTAACCA GGGAAGATGTAAGCTTCACACCATTCTCCTTGACAGTTTTATTTATGCCTTTCAAGTCAACCGGGTCGATAATAGCAGCA TCACTGCTCTTTTCATCAACCCAAAGATACATATAATTATCACTCAATGCTGGGACAGGTATGACTTTCATTTTTCGGTC TACAACACTTCTCGAAAATTTTCGACTTACAACCCGTAGTAATGCGAGGTACATACAGTGCCCCTATGCACCACAGAATG CAGCCTCAAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_882: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299994914363H39282SWAMCA274SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
354109992883H52887SW3ICA431SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445721167373N43129SW3ICA1076SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11161172199258AA471494MBAFCX3B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814532655573AA675867MBAFCW5G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:25:47 on Fri 17 Nov 117.