CBrugiaQ_892


Sequence

>CBrugiaQ_892 (8 EST) Length=515 TTNAACTGGTATTCCAGGTGGACTGGTGGTCCNGCTTNCCCTGCTGGACCTGGAGGTCCGGGTGGTCCAGGTGGGCAAGC AATGCAACCCTCCGCGTGTTTTCTCACCGGTTGATATAGCAATACCATTTGGTCCTGGTTTACCATCCTTACCATTTTCA CCTGGTTCTCCTGGTAAACCAACATCTCCTGGTGGTCCAGGTGGTCCTGGTGGACAATTTACAGCTTGAAGAGCACATGC ACAGATAGCACGACGTTTTTGACGTGGTTTTGAACCAAACAAAAATGCGATTGATTCTTTTTTGGATATAGGTGAATTAT GATTCACGTGAACACTCATTATTTCATCCCATGCATCATTTGCTAATACCTTAAATTCATCCATATCATCTAATACTTCA TAATAAAAACTATTAATATCTTGCAATAAGATACCAGCAATAATTAATGATACAATAATAACTAAACCACTTGCAATGGA TGCTATATTAACAAACACTTGTGTTCCCATTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_892: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343556973960R95230SW3ICA378SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445971167398N43093SW3ICA1102SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447021167599N43217SW3ICA1139SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447931167690N43308SW3ICA855SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7062361592654AA072553MB4SLD032T3Brugia malayi L4 JHU93SL-BmL4
8983071892912AA257410MB4SLM2H9T3Brugia malayi L4 JHU93SL-BmL4
11887322289596AA542684MB4SLY2A10T3Brugia malayi L4 JHU93SL-BmL4
12617562392952AA585540SW3D9CA120SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 7:36:23 on Sat 18 Nov 117.