CBrugiaQ_896


Sequence

>CBrugiaQ_896 (2 EST) Length=507 AAAATTTCGGGGAAGATCATTTTAGGAATAATTCCAGAATTTGGCTAACCGGTATNGCCGAAATTATTTCGCGGACCGTT NGGATTCATCAGCTGTAGGAGTTGCTTCTTCCAATTTATCCGTTGCAATCTTCAAACGTTCCTCTGCTCGTTCCAATTCC TCTTCCAGAAGTGTCATACGACGATTCAGGGCTGCTACCTCAGCCTCCGCCTCCTGAACTTTCTTTTCCTTCTCTTCCAA ATTAGTATTTGCAACAGCTAAATCCTCTTGTGCTTTATCTAAATCATTCTCTGTTGGCATCATTTTCTTCTGGGTATCTC GAAGTTCTTCCTCAATTCGTTCCAATTTATCTGTCATTTGTCGCACTTTTTCTTCTGCAGCATCGGCTCGATCGAGAGCA TTATCCTTCTCGATTTTCATCGCCTGCATCTTTTTCTTGATCGCATCCATTTTTGCTTTAGTTTATAGCAATTTAATTTA TTCAAATATCAAAAATAAGCTTTCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_896: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982031892808AA257306MB4SLM1D11T3Brugia malayi L4 JHU93SL-BmL4
12617732392969AA585557SW3D9CA148SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 16:20:58 on Sun 19 Nov 117.