CBrugiaQ_913


Sequence

>CBrugiaQ_913 (3 EST) Length=752 TCTCCCTCAAGCGACTNACATAATCTTTGAGTGGAGNCATCTCCTCGCAAGATGCTGATGATAGATCGTAAGAACNCCGA AGTTTTTTCGAGGGTCGAATCTTCATGAATACCAACCTTTATATTCTTCGAAAACTGTTCGTAAAACTTTTTGAAGTTGT CTTTGTCTTCCGCGATTTCGTCGAACAATTCAAGGCATTTTTTGACAAGATTCTTGCGAATCACCTTCAATATCTTGGAC TGCTGCAACATTTCACGGGAAATATATAGCGGCAAGTCCTCGCTATCAACAACACCTTTGATGAAGTTCAAATATTCTGG CATCAACTCGCCGCAATTCGGGGCGCATGATGAACACTCGGCGNACATAGAGCTTGATAGCATTCTTTGTCTTCTTATTC TCAANCAAATCAAATGGTGCACGTTGTGGTACAAATAACAGAGCACGAAATTCAAGTTGCCCTTCAACTGAAAAATGTTT GACTGCGAGATGATCATCCCAATCATTCGATAGTGATTTGTAGAATTCCGCATATTCTTCATTGCTTATATCATCAGGAT TACGTGTCCAAATAGGCTTTGTCTTGTTCAGCTCTTCATCTTCATGGTACTTCTCCTTGATCTTTATCTTCTTCTGTTCT TTATCCATCTTATCTTGTTCTTCATCAATATCCAACATCCTCAATCTCACCTTCAATAAATTCCTTATCTTCGTCCTTCT TTTCTTCTTCCGCTTCATCATCAGAGAGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_913: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458741182891N44372SW3ICA1210SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13813652655485AA675779MBAFCW4F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814402655560AA675854MBAFCW5F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:3:27 on Thu 23 Nov 117.