CBrugiaQ_925


Sequence

>CBrugiaQ_925 (2 EST) Length=503 CCTAACAAGAACCATNCTTCCTTGATAAGACCGNTTCGCTTTTCTTGACCCTCCAAGTGTCCTACTNATAATATTAAGTT TTTGTTTCGTAAAAAAGCAAGTATGCAAGTTTTTTGGACGGAAGAGGAAGAAATTGCAAGAAATGATACATGTTCCAAAC ACTGCACTTCTTCACGTAAATCAGGTATCTTAGAGATGACTTTCTTTAAAACCAAGATGTACAAATCTCTATGTCGAAAG AAGCTAGAATCCAGCTCTCTTAATCTTTTCGGACCGATTTTTACTGTGTTGGACAACAAGTCTACGAAACCGGAAAGTGC ATAATTTAGAGGCTCGGCTATGACACGCTTGCCTGCTTTATCGACAGAAAATGCTTTAATTTTCATTAACTCCTCAGCCA AATCTTCTGATAGGAAGGTAGCAAACTTTTCCTTCCAAATTTCTGCATCGCTTCTGCACTCCATTTCACACCCTTTTGGT ATTACAGTAGGTCTGTTGGTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_925: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451101182137N43557SW3ICA929SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8983441892949AA257473MBAFCZ0D2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 23:53:54 on Fri 17 Nov 117.