CBrugiaQ_930


Sequence

>CBrugiaQ_930 (4 EST) Length=790 GGCCCATTTGGGAACTGTTGATGATAANTTTGATAAAGATGAAAATGGCGCATTTTGTGGCTGCTGCTGATTTTTGTGAT AAGTTTGTGATTGTTGCGGATCAACTGGTGATTAAGATGAAACCATGGGCATTGTTTGGTGATTTGTTGTTGAAAATGGA TGACCCGTTTCAGTAATATGGTGTGTTTATTTTAGCGGAATTCGGAGTGGTCCGATGGAACGTTTCCCGGACCCGGGCAT AGGGTCGACGGGTATCATTTGGACGAAGGCATTAAAACGCTGTTTCCGGGCTTTATTTCTTTCCAACGGGACATCGAACG AGCCGTTCGACCGATATCGTCCAGACAATTGTTGATCCGTTCCGTCCAGTCGTCCATTGGATAAATTCTCGATGTCACCC TGTAGCGATCGACCGTACTCGGTCTTGCGTAAGCCAGCGACTGCGTGCTGTAATGTCTTAGCGTCCAACCGGGGAGTGGT GGGCTTGGGCGACGCAGATACGGTAGAATGTGCTTGTCGGTTACTATCGGTTGATGACCTCCAGCTAGATGATAAAAGCG ACGAGGTAGACTGTAAAGGGGGTGGAGGAGGAGGGGCTGGGGGCGCGTCCATTCCTCAGCGTACGTGTCGCGAACGTTGG CGTAGGAGTGACTTCGACGTCCTCGAATTGATCCTGGAAAAGGAAACAATGGTAACGGTGATAAATAACTTGTCATTATC AGTCGTCGTTACTCGAACAATAATGAGTCACCACCACAAAGTAAACATAAACGACACACACAGACACAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_930: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447921167689N43307SW3ICA854SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9214911923342AA280481SWMFCA2144SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9245941926196AA283502SW3ICA2624SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12617422392938AA585526SW3D9CA104SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 17:6:32 on Wed 22 Nov 117.