CBrugiaQ_942


Sequence

>CBrugiaQ_942 (5 EST) Length=633 GTTTGAGCAGAGCTTTTGTTCTCGTATGTCAANATAAGNNNNANCNGANACAAAAATGTGCGACGAGGAAGTAGCAGCAT TAGTAGTAGATAATGGATCCGGTATGTGCAAAGCCGGATTTGCTGGTGATGATGCACCTCGAGCTGTATTCCCATCAATA GTTGGACGACCAAGGCATCAAGGTGTCATGGTCGGTATGGGTCAAAAGGATTCATATGTAGGCGATGAGGCTCAGTCGAA GAGAGGTATTCTAACACTAAAATATCCAATTGAGCATGGCATTGTCACAAACTGGGATGACATGGAAGAAGATCTGGCAT CATACTTTCTACAACTCAATATGATGAGTTGCGTATATTCTGCGTTCACGCTAGCTGGGCGACGTGTTCGCATTTTAACC TTACGCAGAACATGTTTTTAAACTGTAATATCAATTTCCACTCCCTACTTCATTTCTTTTACTACCAAAAATTTGCAAAA ACTAGTTATTTTGTCAACACTGTGTCACACGAAATTTTCAATCGCCTGCATATGAACTGAGTAAATGAATGAATTTATGT GCTGTTTCTGGTCGTTAAACATACTTCTTCTTGTTGAAATAAATCAATTTCTTGGCTTATTTGATAATACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_942: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5014411266962N94681RRAMCA1151SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12618412393037AA585625SW3D9CA346SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13667202605258AA661214MB3D6V4C01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13860552660417AA680469SWAMCA3054SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13870692663009AA681004SW3D9CA525SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 20:46:0 on Sun 19 Nov 117.