CBrugiaQ_944


Sequence

>CBrugiaQ_944 (2 EST) Length=702 TGGTAGGAAATGGTTCATATCAAAGGGCAAAAAGGATAATGTGGAAGATTCAATAGCCAAATTCAATGGTCAGTGGGAAA TAGGCACTCCTTCAACAGTCGTGATCGACAATGACTTCGGATTAATTGTAAAAAGTAGAGCACGACATCATGCAATTGCT TCAAAATTCAGTCGTCCATTCAAATTTGATGGCAAACCTTTAATTGTGCAGTATGAGGTAAAATATGAAGAAAGGACAGG AATGTGGTGGTGGTTACCTGAAATTATTAACGGAGGGTATAGAAGCACTGGAAGAATTTACAGATAAAACACCATATACG ATAATGTTTGGACCTGATAAATGTGGTGCCAAGTCCAGTATCCTGTTTATTGTTCGCTTCAGAAATCCCAAAAATGGCAC TGTTTCTGAGCACCATGCGAAACAACCATCCAAACCAGTTTCAACATATTTTGACGATCACAAAACCCATTTGTACACTC TGATTGTTCGACCAGATGAAACGTTTACTGTGCTGGTTGATGAAAGTAAACTTATATCTGGTAGCTTGATTACAGATCTC GAGCCCATCCGATTACTCCCCCCAACTGGTTTTTGATGATCCCGACCAGACAAAAAGCCCTGAGACTTGGGATGAACCGT TGAAAAAATCCATGATCCCGAATGCCCCAAAAACCCTGACGAACTGGGAATGAAAATGCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_944: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6722091537156AA051991SWAMCA1471SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807131547276AA054869SWMFCA820SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:43:7 on Mon 20 Nov 117.