CBrugiaQ_946


Sequence

>CBrugiaQ_946 (3 EST) Length=700 ACCCAAGTTTGAGTGTTGTTCGATGGCTACCAAACGATTCACTCAAAGTGCTATCAATTTCAAAACAGTTAGTGATTTGG TTGGCGAGAAGCATGCTAAAGAAGTTACCGCATTAGCACAACATCATCAACATTACTTGAGTACCGTGATGTCTAAACCT GCGGAACTGCCAAAATATGATTTTGCTAAGTTGAAAAAGCAAATGCCTGAACATGCGATTGCTTTGGACAAGCTGCAGAA GCAATATGAAGCAATCAAAATACCGTTTCACTCAGTACCAGAGCAATTCATGAAAGAGATTGATGATTATTTGAAATACG TTAGCACAAAAATGGATTTTCTCAATCGTAAGCTGACTGATGCTGCGGAAGATGAAAAAAAAATCNAAGCGAAATATGAA AACATGCCACCGATTGAACATTTTCGACCAGAACATTATGGGAAGTTCTTTCCTGAAGTGCACCGTGACGTCCGCTTGCC AATTGATCGTTTTACGACGGGTTGGGGTTAGTACAAATACTCCCGAACATTTCCAAGAATTGAAAGAACTCTTTAAAGAT TATCGATCACGTCCAGTTCCCGAACACTTGCAGAAATGATTGTGTTTGCATGTAGGTAGCTCTGTAGAAGGATTTTTTTC TGTGGAATTTTGTTATCTTTTTGTGTGAAATAATTCATCAATGATAAAATCTAGTTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_946: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5594011345222W51520AS4SLC490T3Brugia malayi L4 JHU93SL-BmL4
6186181463719AA007714SWAMCA811SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11939672315119AA547918MB3D6V2G06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 14:41:55 on Sun 19 Nov 117.