CBrugiaQ_951


Sequence

>CBrugiaQ_951 (2 EST) Length=533 TAAAAATATATACAATTTTCTATAATTGTNTTTGTTTTGGAAATAATCAGAATTATTTCAATTCATCATAATCCCTTTAA CATTANTATATTGCGTCATCTCTTACGTGTACTTTCATATTAGGTCACGTTCNTCTTTNGGGAATATTGTCTCCAAATTC AGTACACCAACGTCAAAAGCTTTCTTTGCAGTCGAACCGCCAGAAATATACTGTTTTGGTATACGTAGCTTAACCTTTCT TTTACCAGGTTTAATACCATCATCACAATCATGATAAATCTTAAGTACTGGATCAATACTCGTCAATTCTCGGGTACTAC CCTTCAAGATTAAAATTACCATCCCGATCTGTTTCACCTTCATCTCAATACATCATCCGGATCCGGTCCATCATCTTCAT CCCACAGTTTAACCTTAACACCTGATGCTGGCTTATCACCACACTTTAATTGACCTTTAACCCGCACAGCTTGAAGTCGC ATCCCATTACTAATACTAAGTATTGTTAGAAATAAAAATAATACAGCTTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_951: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12707312405712AA592049SWAMCA1922SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13667932605331AA661287MB3D6V5B05T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 19:20:3 on Fri 24 Nov 117.