CBrugiaQ_954


Sequence

>CBrugiaQ_954 (95 EST) Length=1039 GTAACATGTGGAATTATAGTGCTGTGCATGCACTAGGTGGCTCGNGAGGATGCAGACACATTTTTATTTTTTAACTCAGC ACTCAACCATACGCTATCCGCTGTTTTTTTCGGGAACAGTAATCTACGTGTGGTTTAATTACGCACAAGTTTGAGATTTT GCATTTATCACAATATTTAACAACGACGACATGCCTTTTCTTTTTCATCGTTTGTCTGATGATACAGCAGTAGCGAAGAG AATGTACGAGAAATTCATGAAAAATCCGGCCATTCCGGTTTTTGCATGCGTTGCACTTCAAATGGCATTTTCCATCGCTC GTAAACGTTTCGTGAAAAGCATGTCACAAGCTGAATTTAATCGATCGATCGCATTGGTACCATTTACGGCATTTATTGGT ACAGCTGCCTGGTTTCATGGTACTTCAATTAGAGATCAACAATATATCCCTCATGAAGAATAACTTACGTACAAACTTGG TAAAGTATATTGCGACATTATATATGCATTAATGATTTTGTGAATAGCATATAAAATAAAATATTATTTGATTAGTGTTC CCAAAAAACAGCGGATAGCGTATGGTTGAGTGCTGAGTTAAAAAATAAAAATGTGTCTGCATCCTCCCGAGCCAAAAAAA GTGAAAAATGACAAAAAAAGACACTCTCTAAAAAAAAAAAAAATTGTTAATTGACAAAAACAGAAAAAAAATTGTAAAAA CAAAACTGGCGAAAAAAAGGGGTCCACAAAAAATCACCAAAAAAGTACACTCTCTTTAAGGCANCATCCAGATATGAATG GGATGCTAAACGTCGTATAATGATAGAAACTGAGGACTACCCGATAATTGGCTTTCATCCACCAGAAGCTGATAAAGGAT TATGGGGTGGTGAAACAGTGGTGAAAGGTTATATAAAATCACGTCCCTATACTAGAAAGAAGATTTTACCAAGGCATTGG GTGCCGCATTTTTTCTTTCCGAGTTTGAAAAAAGTTGTTGCATATTCAGAAGTTCTAGACAAACATATGAAAATTACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_954: (95 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217738808560R47673SWAMCA121SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320243945444R86417SWAMCA378SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4809931236230N74831RRAMCA1102SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5061061270733N99318SWAMCA534SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5077081272192W00777SWAMCA581SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5406891313867W32837RRAMCA1215SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5594251345246W51533AS4SLC603T3Brugia malayi L4 JHU93SL-BmL4
5594571345278W51565AS4SLC746T3Brugia malayi L4 JHU93SL-BmL4
5678931366641W59850SWAMCA944SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6186111463712AA007707SWAMCA797SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462421502072AA032100SWAMCA1091SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462481502078AA032106SWAMCA1405SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6806821547245AA054911SWAMCA1500SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807391547302AA054895RRAMCA287SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061851592603AA072477SW3ICA1619SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7271831634828AA089349SWAFCA45SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7271951634840AA089361SWAFCA61SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7471471660757AA109339MBAFCE0A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7471671660777AA109293MBAFCE0C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7471761660786AA109329MBAFCE0D09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472331660843AA109373MBAFCE1B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472681660878AA109408MBAFCE1F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472751660885AA109415MBAFCE1G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7473391660949AA109453MBAFCE2E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522731668257AA114426MBAFCE3C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7523691668353AA114443MBAFCE5E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566121673237AA118188MBAFCE6C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566561673281AA118232MBAFCE6G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7566661673291AA118242MBAFCE6H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620611681929AA123527MBAFCE9A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620641681932AA123530MBAFCE9A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7620711681939AA123602MBAFCE9B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001561737539AA161707MBAFCE9F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001771737560AA161550MBAFCE9H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002211737604AA161594MBAFCF1F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002431737626AA161742MBAFCF7A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002591737642AA161606MBAFCF7B11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002791737662AA161632MBAFCG0A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002811737664AA161634MBAFCG0A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002841737667AA161637MBAFCG0A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002861737669AA161639MBAFCG0A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002891737672AA161642MBAFCG0B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002921737675AA161645MBAFCG0B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003011737684AA161654MBAFCG0C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003051737688AA161658MBAFCG0C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003131737696AA161666MBAFCG0D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003201737703AA161673MBAFCG0E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003211737704AA161674MBAFCG0F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003251737708AA161678MBAFCG0F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8003481737731AA161617MBAFCG0H11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8195901763771AA180553MBAFCF7E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196161763797AA180605MBAFCG1A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196171763798AA180606MBAFCG1A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196581763839AA180647MBAFCG1E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196631763844AA180652MBAFCG1F03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196691763850AA180658MBAFCG2D01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197061763887AA180669MBAFCG2H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197071763888AA180670MBAFCG3A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197151763896AA180678MBAFCG3A12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197411763922AA180704MBAFCG3E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197501763931AA180713MBAFCG3F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197651763946AA180728MBAFCG3H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8982391892844AA257368MB4SLM2A8T3Brugia malayi L4 JHU93SL-BmL4
8982971892902AA257335MB4SLM2G9T3Brugia malayi L4 JHU93SL-BmL4
8984701893075AA257599MBAFCZ1G8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985071893112AA257545MBAFCZ2C8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985681893173AA257696MBAFCZ3A1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986111893216AA257648MBAFCZ3E3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9164481917068AA275433MB4SLY1E02T3Brugia malayi L4 JHU93SL-BmL4
10480492064696AA406730MBAFCZ3A01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480772064724AA406758MBAFCZ4A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481852064832AA406853MBAFCZ5H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481942064841AA406862MBAFCZ6A04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482192064866AA406666MBAFCZ6C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10614292078579AA417408RRAMCA1392SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10614512078601AA417430RRAMCA1416SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10750672113544AA430787RRAMCA1450SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777052130888AA433411SWAMCA1886SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777152130898AA433421SWAMCA1898SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10988902168060AA454391MBAFCX1A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989392168109AA454440MBAFCX1F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160482199189AA471425MBAFCX2D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11161642199305AA471541MBAFCX3F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162082199349AA471585MBAFCX4B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536042246818AA508941MBAFCW1D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537562246970AA509093MBAFCX7B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539252247139AA509262MBAFCX9B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539592247173AA509296MBAFCX9F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652242402595AA588932KJ4SLB409T3JHU93SL-BmL4 (JHU)
13247722539415AA627028MBAFCW2F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668692605407AA661363MBAFCW3B04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13668702605408AA661364MBAFCW3B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13669332605471AA661427MBAFCW3H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813402655460AA675754MBAFCW4D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814362655556AA675850MBAFCW5E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:17:59 on Thu 23 Nov 117.