CBrugiaQ_957


Sequence

>CBrugiaQ_957 (2 EST) Length=497 AGCAAAATATGAAAAAGCACCGGAGCAGTAGGGCCATACTTGAAATGCAGACTAAAGTTTGACTGGCACATCAAGTCTCA TGATACATCAAATTGTTTCCTGAATTCTTTGGTTGAATTTCTTCTGGAAAAAGGTTTCAAACGACCTGAAAAGGTCAAGC GAAGTACGGGACAAAGTGTTATGAAGTCTGCGACTTGTAATCCGCAAAGAACAAAAGACATAAACATTTCGGAAAGGGAC AACGCTGTGGATAAAACCCGGAAGTCTTCGTTCGCTTTGATTGGAATGCGTTCAGTATTACGTAGTATGCAAAGGGATGT GTTGTCAGCAGTATTCTTTGACACAGTCACAATCAAGCCATCAGCAGTTACAACTACTTTGGGACTGTATGCTACCAGCT TACAGAATACGAAGGTATACGCCATCTCTGGCTTAAACGCTGCTCTTTCAACAGCTCTTAATATGCCAATGGTGGGAGCT GTAGGATTGATAAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_957: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751102113587AA430765RRAMCA1505SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10988252167995AA454326MBAFCX0C06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 6:54:45 on Tue 21 Nov 117.