CBrugiaQ_958


Sequence

>CBrugiaQ_958 (2 EST) Length=500 CTCAAGTTCCACAATATCCTCAACCTCCACAATACCAACCTCCGCAATACCAACCTCCGCAATATCCCAAAGCTTCAAAA TATCCGCAGTATCCAACTGCTGGTGCAGGAATGGTAGGATCATCTTTATATGGAATATATGAAGAAGATTCTGATCAAAG TTTAACTGATTTTGAGCAATATCAAATGAGTTTCACTTAAAAGCAGAAATAGACTTCTTACGTTACTGTATCCAGATATT TTATGCATATTTCTATGTCTTGTATGATAAATCTGAATAATTATATGTATTTCTGATGATTTATAAATGGATTATTTGTC TTCCTTCATGTTGATGGTTAAAAGAATTAAGTCAAAAGAATTCAAAACAATCAAGCTTATATTTTATCAAATAGGTACAA TTGATGATAAACTTCATTCATACACTTAATCAACTTTTTTTCTTTTAATTATTTGTTATTGTAAGTTTGAAGATTTCTAT ATAATAAAATAATTTGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_958: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472421660852AA109382MBAFCE1C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11535672246781AA509332MBAFCW1A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 22:9:53 on Fri 17 Nov 117.