CBrugiaQ_963


Sequence

>CBrugiaQ_963 (3 EST) Length=496 GTTTGAGACAATATTTGACCGGAGAAAAATTGGTTTATAATGGGGCTGACGATATCAGGCCTCTTTGGGCGTCTCTTTGG CAAGAAGCAGGTACGAATTTTGATGGTTGGTTTGGATGCTGCAGGGAAAACGACCATTTTGTATAAATTGAAGTTGGGTG AAATTGTTACTACTATTCCAACTATTGGATTTAATGTGGAAACAGTAGAGTATAAGAATATTTCTTTCACAGTTTGGGAT GTTGGCGGTCAAGATAAAATCCGCCCACTTTGGAGACACTATTTCCAAAATACACAGGGCTTAATCTTTGTTGTTCGATA GCAACGACAGAGAACGTTATTGAAAGAAAAGCCCGAACCTGAAACTGCCATAAGATGCTTTCCGGAAGAACAACTTCCAA GATGCTACTTTGCTTGTTTTTTGCCAATAAGCCAAATTTGCCCAATGCTATNATTTCCCCCTGAATTAACTGATACCNTG TCCTTCCTATCTGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_963: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10988812168051AA454382MBAFCX0H05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617112392907AA585495SW3D9CA033SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617242392920AA585508SW3D9CA055SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:5:18 on Mon 20 Nov 117.