CBrugiaQ_965


Sequence

>CBrugiaQ_965 (3 EST) Length=821 TTTCAAATTTGAATGAATTATTTCACTTAATGTAACATCATAACACGCATCAGTGTTTTCGTAATTGAATACAATCGCGA GTTTCCTCCAACACAATTTGCCAACCTAAATTCCAATTTGTACCCCGCATTAATACCCATTTCCGTGGTGTTTTTGCCTC CTGTGAAATAACCATCTGGTATCATAATGCTGATTTTTCTCTGGCATGGCTTAATTCCATCATTGCAGTCATGGTAAATG TTGAATTTCGGATCAATTGGTGACATTTCATGTATGTAGCCGGAGAGCTCGAAATTTCCTTGCGAATCAAATTTTGTTTC ACCCATGAAATCATCCATATCAATTCCTCTGTCATCATCGTATAATTTGATAAGTACCCGAGGTGCAGGTCGTCCGTTGC ACATTAATGTACCTCGAACACCGGTGCTTTGTACACGTCCAACTAAGCCACCAAACGCACAAAATACAATCGGCAAACTG ATTATTAATAATAATAATAAACGGAACAATAATAATAATGGTAATAACAATAACAATAATAATAATCATGACAATAAAAT AATGATAACAATAATAATAACAACGATAATAATAAAAATAATGATAATGAATGTACAATATAAACATTTNGTTAATTACA GTAAAAGAATACAGCAAAATTTTGGTNTAAAAATTTATTTTTCAACTGAATATGCATACTGGATGAGAGATGCTTTNATT TTCTGTTATGTACAGTCTTAACAGGATATGATTTCACAGAATTTCTTACTAAAAATTGCGAAATATCTCATAATTATNTC GAAACAAATAAAACATTTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_965: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255661141667N27319SWMFCA238SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5251831293889W18215SWAMCA662SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12618742393070AA585658SW3D9CA408SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 14:24:12 on Sun 19 Nov 117.