CBrugiaQ_976


Sequence

>CBrugiaQ_976 (2 EST) Length=494 GCTGGCCGTATTATGATAGCTGTTGCAAGAGTTTTGGCGCTTTCAGTTCATCACAGATTGCAAATCCGGAATCCTCTATT ACGATTCTTTGGTGAGCTTCATGTTTTCACGGAAAGAGCCATCTTGGATTGTTCGGATACAGTGGATGCTGCGGAAAAAG CTAGGACTGGATACAGAGGATCATTATTATGGATGAAGAAAACGAGTAAAGAGCTTGACCCAGACGCAGAAAATATTTTG GAAAAATTTCGTACAGCGCAAAATGTTGTTAGGCGAAATAAAGAGAAACTGGATAGTTTGAAATTGGATACTCTTCAGAA AGTTGATTTATTGGTCGCTAGTCGCTATAATTTATTTTCGCAGCTGTTGGAATCGTATCAGAAATTATTATACAATTATT ATGAACAAACAACGCTGGCATATGAGAAGATTATGATTTTGTGTCTAGTCGTAAACATTACGAATTTGAAGTACTAACGG ATCTGCTTGAACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_976: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12617172392913AA585501SW3D9CA046SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13669352605473AA661429MBAFCW3H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 21:55:21 on Sat 18 Nov 117.