CBrugiaQ_977


Sequence

>CBrugiaQ_977 (2 EST) Length=512 NTTAGGATAATTTCCAAAATTTATTGGGTAAGATTTAAACCCATTTNGCCGAATCCCATTGGTTGAATAAATAAAGTGGA ATCAAGTTCCGAATAAAACCAATAGCGTGCGTTATCATTAATAATCCGTAATTGATGCATTCCTGTAGTATGATGGATAA ATGGATGCCAAATCCATATAAGATGATTCTTTGTATCTTTAGCCAAGAACTATATGGATAATTCCCACATGCTATATGGT GCTTTATCAGTTCGAGAACGCGGTGAACTCCCCATATAACAATCAAACCAGTAATCATCATACAAACTCCAATTTCTATA TTGTTGATTTGGCCCAAATGTTGCATATTTCTCATCATTTGCTAATTTTTCCAATGATTTTGAGCGATATAACGGATATA TTGGCTGCAATAATGGAGGCATTTTATTTGCAACATGATTGATAGAAAATTTAAATATTCAATGGAATTTTCAATTTCTT TATTCGACAATAGGCAAGCAAATACAAACGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_977: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343550973954R95224SW3ICA370SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446171167418N43113SW3ICA948SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 10:5:19 on Wed 22 Nov 117.