CBrugiaQ_978


Sequence

>CBrugiaQ_978 (4 EST) Length=497 CTCGTGCAAGTTTGAGAGCGATTGCTGAAGTGTGATTTTAACTCAGCGAAAGCAATTTGATAAAGGTAGGACACAATGCC GCGTGTAAAGAATGTTATGTCAAAGGTGTATAAAAGTCCGCGACGTCCATTCGAGAAGGAACGTCTTGATCAGGAGTTGA AACTAATTGGAGAGTTCGGTTTGCGTAATAAGCGCGAAGTGTGGCGTGTGAAGTACACACTAGCAAAAATTAGAAAAGCT GCTCGGACATTGCTTACGCTTGAGGAGAAGGATCCAAGACGTTTGTTTGAAGGTAATGCATTGTTACGACGACTTGTTCG AATTGGTGTATTAAGCGAAGATCGCATGAAGCTCGATTATGTTTTGGGTTTACGAGTTGAGGATTTCTTAGAGCGTCGTT TACAAACTCAAGTTTCAAACTCGGTTTAGCTAAATCGATTCACATGCTCGTGTTTTGATCAGGCAAAAGCATATTCGCGT TCGCCGTCAAATTGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_978: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7484471662318AA110571SW3ICA1723SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7566371673262AA118213MBAFCE6E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10614382078588AA417417RRAMCA1402SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11160722199213AA471449MBAFCX2F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:48:24 on Sat 18 Nov 117.