CBrugiaQ_980


Sequence

>CBrugiaQ_980 (41 EST) Length=1683 AACTNAATATCATAAAGTTTATTTATATATTACATTAGTAACACAAAATAGAAATGTCAGATCAACTGAGAGCTTTATAT TATCATACCTAGCACTATATATTTTCCTTCTAACAAACTGCATAGAAATTGCGTAGACGATTTCCTTTTCGTTATTCTCG AACGCTACCAAAAAGCGATCCACCTTCATCAAGATCGGTTTCCAGGATGTTCAAATAAATGTCGTAGAGGCTCTTATCTC CCTGTTGTTTAACGAAGAATTCGTTCTTTCTCTGCCTCTTCAAGCTTCTTCTCATGTTCTTTTTGTCGCACAATTGCATG TTTCTCGCAAATCATTTGATAGCGAAAATATCCCCAAACAACACCTAATCCAAGGAAGGAATAACGCATAAACCGCAACA GAGGTGATACACGAATTGGCGACGGTAATATAATTTTGGTCGGATCCGGCTGAGAACTCATTTTTTCCCAGANCTCGTGC CCAATTCGAGGACAGTATGTCACGACCTAAAGTATTCTTCGATATTACAATTGGTGGAAGTAATGCAGGACGAATTGTCA TGGAGCTTTTTGCTGATATTGTACCTAAAACAGCTGAAAATTTTCGCTGTCTCTGTACCGGCGAAAGAGGTATGGGACGA AGTGGTAAAAAATTACACTATAAAGGATCGAAATTTCATCGTGTTATACCTAATTTTATGCTACAGGGTGGTGATTTTAC ACGTGGAAATGGCACAGGAGGTGAATCAATTTATGGTGAAAAATTCCCTGACGAAAATTTCCAGGAGAAGCATACAGGTC CTGGTGTCTTATCAATGGCTAATGCGGGACCAAATACTAATGGTTCTCAATTCTTCATCTGTACTGCAAAAACAGAGTGG TTGGATGGAAAGCATGTGGTATTTGGTCGTGTTGTAAAAGGTATGAATGTCGTGAAGGCAGTCGAAAGTAAAGGATCTCA AAGTGGACGAACATCGGCAGATATAGTAATTTCAGATTGTGGACAATTGTAATAACACATATCGGAAAAAGCAGTTTCCA TACTGTTGACCATTAATACAAAATTATGCCCTTTACGAGCAATTTNGGTTATTTGTATGCCACTTTGTTTATTAAATTCN TTAATATATNAAAAAAAAATTACTTTTTTTTCCAATTTCAAAAAAAAATAAAAAAATAATCCAAAAAAAATTAATAATAG TAATACACGATCACAAACCCATAAGCCAAATATATATCTGTTTTAAATGACAAAACATAAAAGCATTACAAATAAAATAA AAACTAAACAATCATACATGTGCCAATAGAGTTAACTAAAAAGGAGGGCTCTCCATACGCATATTCCAAAGAAAAATCCA AAGTCAGTCAATATTTTTTCGGTTTAAATAAAACTTTACTCCCGAATTAATTAATTTTGATTACCTGGGTACTAATCCAG TTCAAAAACCAAATTTTAATTGTCTCTTCAAATAATAAAAAAAACTAAAACATTTTACAAAAATAACATAAAAATATAAA AATAAAAAAAGACAAAACAACAAATAGAGTTAAAAATTAAAATGTATAGCCGATTATTCTGGAACACTTATAAAACAATC AAAAAACTACCAGTGAACAAAAAATTACACATTAAATAAACTAAAAATAAGTAATATTATCTTAATACAACCAAAACCAA ATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_980: (41 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217759808581R47694SWAMCA155SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
281194889951H21256AS3ISB159SLBrugia malayi infective L3 JHU93SL-BmL3
296558902913H35863SW3ICA194SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
299939908743R47699SWAMCA162SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
320169944785R86379SW3ICA328SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320173944789R86383SW3ICA332SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
343526973930R95200SW3ICA379SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4426771164825N41227SW3ICA1062SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448141167711N43191SW3ICA910SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451571182184N43656SWMFCA163SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4459741182991N44472SWMFCA194SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5305211300271W23408RRAMCA1298SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6000791416502W91796SWAMCA1048SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6001171420955W91871RRAMCA195SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6186321463733AA007728SWMFCA403SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6364681486233AA022451SWMFCA703SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6462401502070AA032098SWAMCA1088SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6807101547273AA054866SWMFCA816SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6807161547279AA054872RRAMCA222SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6825831549411AA056781SWAMCA1512SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061541592572AA072471SWAMCA1579SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7471631660773AA109289MBAFCE0C02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7471711660781AA109324MBAFCE0D02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8808291870813AA241495MBL2SJ0B4T3Brugia malayi second stage larvae JHU96SL-BmL2
8984081893013AA257511MBAFCZ1B3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8987221893327AA257811MBL2SJ3G11T3Brugia malayi second stage larvae JHU96SL-BmL2
8987781893383AA257867MBL2SJ4E5T3Brugia malayi second stage larvae JHU96SL-BmL2
10481082064755AA406646MBAFCZ4D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10614652078615AA417405RRAMCA1433SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777162130899AA433422SWAMCA1899SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987652167935AA454266RRAMCA393SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11160712199212AA471448MBAFCX2F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11888372289701AA542789MBL2SK3F05T3Brugia malayi second stage larvae JHU96SL-BmL2
12212172344711AA570821SWMFCA2568SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212942345191AA570898SWMFCA2671SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247282539371AA626984MBAFCW2B09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13667572605295AA661251MB3D6V4F07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668762605414AA661370MBAFCW3C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813472655467AA675761MBAFCW4D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870572662997AA680992SW3ICA2695SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
13946092675714AA688432SWAMCA3099SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:47:37 on Fri 24 Nov 117.