CBrugiaQ_982


Sequence

>CBrugiaQ_982 (8 EST) Length=664 TGTGCCAGCCCAAGCGTTCATAGCGAGCCTTAGCTTTTTGANCCTTCGATGTCGGCCTCNTTCCNTATCAATTNGCGAAG CAGAATTCGCCCAAGCGTTGGGATTGTTCACCCACCAATAGGGAACGTGAGCTGGGGTTAGACCGTCGTGAGACAGGTTA GTTTTACCCTACTGTGATATGTTGTTGCGATAGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGGTTC ATGTGCTTGGCCGATCGGCCAATGGTGCGAAGCTACCATCTGAGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCAC CTAGACAAGGCAACGATAAATTTGCTCCCTGATGTCGGGAGGCACTATTATGTAATTATGAACATATTCATACTATTACA GCTAATGCCCCATTATATGGCCTTGCTATTTAATCGAATGGTTAAATGGTTGCCAAAACCGGATTACTCTGGTACAATGT CGGGGCGCAAGATCACTTGCAGACGACTTGATTACTGGTCAAGGTGTTGTAAGCAGTAGAGCAACCTCCATACTGCGATC CGAANTCNGCACCCGGANATAANNAGTTCTCCAAACACAAAAAATAAAAAAAAACAATAGAATTAAAAAAAAAAANTTTA TTAANCANTTNAAAAAAAAAACAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_982: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299956914325H39244SWAMCA115SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5251671293873W18199SWAMCA644SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462451502075AA032103SWAMCA1097SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8640321845480AA224696SW3ICA2026SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8675961849826AA228255SWMFCA665SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10777132130896AA433419SWAMCA1895SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987402167910AA454241RRAMCA229SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13946102675715AA688433SWAMCA3100SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:51:55 on Wed 22 Nov 117.