CBrugiaQ_989


Sequence

>CBrugiaQ_989 (3 EST) Length=493 CGGTGGCGGCCGCTCTAAAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGCGAGGATACTATATCACTAATAA TTGTTTCATTCTGTCTGCAAATTATCCCACAAAGAAATTTTCACGTCATTCACGTCATTTTGGCTTTTGTCATAAGTATC TATTCCGGTTAATGAGAAAGCTCTACACGATTTATTTAACCAAGCAACAATTATGCGACGATTCAGTCAGAGGAAGTCTC GTACTCGCGGGACAATCATTCGTGGCAATACGATGTCATCCAGTTCATTATCATCCAAACATGATTTCTCCTACACTGAT AATGATTACGATTATTTTTTAAGTGATGCACTGGTAAATGATATTGAAAATTTTGCAAATCACGCAGAACGATTGCGTCA ATCGCTTGATCCTTCTATCAATGCAAACGATGGTAAGTCAATGTGTGTATCGGTACATTCAGCACTTTCAATGGTATCAC AAACAGTCCGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_989: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10482642064911AA406919MBAFCZ6G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160502199191AA471427MBAFCX2D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11535832246797AA509348MBAFCW1C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:4:17 on Mon 20 Nov 117.