CBrugiaQ_990


Sequence

>CBrugiaQ_990 (3 EST) Length=496 GTCTGNTCCTCCAACTTACNACCACTCGTACTTGAACCTTTCTGACCTGCAAAGGATCAAGCGAATCCAACATATACATA CAAATCGTAAGCAAGTGGAAAATTAAGTGATGTCTCGCTTTCTGCCTCCAGCAATAAAAAGCCACTTATGCTGTATTGAT AGCTACGATCTGCGCCTCAGCAACGAATCGAATGGAAGGCAACTGTATACATATACAGTAACATGGCATGATTTGCAACA ATTCAAGCAATCAAATTCANCGGATGATGTGGGATTGACAACTGTATCTCCTCAATTCTCATTTATGAGTGTATCTCCAA AGCAAGATATGTCCTTAGTAGACATGAACATTTGTNAACGTATTCAACCAACTAATGCTCCTAGTTCTCAAATTCGAGAA TGCCACTGTGATGGACCATGCGGGAAAAATAAAGCCAGTGGGTGAAATGCATATTATGGGTCTATGTGATCATTACATTT GTCGAGATTGTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_990: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5305171300267W23404RRAMCA1293SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5477081322262W39851RRAMCA157SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774492125753AA433155RRAMCA1594SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:23:24 on Wed 22 Nov 117.